Chapter 267: Grand Slam (5)
Chapter 267: Grand Slam (5)
—I heard you asked the secretary’s office to look into the Lofair family.
Young-Joon was on the phone with Park Joo-Hyuk. It was an international call late at night.
“Yeah,” replied Young-Joon, who was lying in bed just before falling asleep.
—Why do you sound so dejected?
“It’s nothing.”
It was because Young-Joon wasn’t able to meet Doctor Ref.
—I can tell something’s wrong.
“The CIA refused the interrogation,” Young-Joon said.
—The interrogation?
“Meeting Doctor Ref. They told me not to worry about it because they have their own doctor for prisoners.”
—Then just forget about it.
“...”
Doctor Ref was suffering from myelodysplastic syndrome. Not only were the blood cells produced by the bone marrow abnormal in shape, but the production efficiency was also low, resulting in pancytopenia, a condition in which the number of red blood cells, white blood cells, and platelets was lower than normal. The disease itself was quite challenging, with a bone marrow transplant being the only treatment currently available.
Doctor Ref was taking a drug called Decitabine. It was one of the drugs that suppressed abnormal blood cell production. It couldn’t cure the disease; it just managed the symptoms. But now, she was reaching a limit.
A-GenBio’s stem cell therapy could be a potential way for her to be cured, even if there wasn’t a suitable bone marrow donor. But Doctor Ref hadn’t used this method yet, even though she was more than capable of replicating Young-Joon’s technique on her own.
‘Because it doesn’t work.’
Doctor Ref’s myelodysplastic syndrome had a different mechanism than most patients. She was born through genetic engineering, and while she was around Young-Joon’s age from when she was born, her cellular biological age was equivalent to that of her mother, Elsie. This disparity would have created a fatal error in the pathogenesis.
There was too much panic in Saudi Arabia for Young-Joon to take a closer look at her with Synchronization Mode. To succeed in curing her, he would need to observe her in Synchronization Mode, but he couldn’t meet her.
“The U.S. government is just going to kill her,” Young-Joon said. “The doctors can’t cure her on their own with current medicine. They’ll need other new technologies, but canceling my scheduled meeting means they don’t want her to recover at all.”
—And you think that’s the Lofair family’s doing?
“I’m just suspicious, that’s all. I don’t know what happened. But how do you know what the secretary’s office is doing?”
—They didn’t tell me, but they consulted me on a couple of lawsuits that the family was involved in. I just knew that it was about you. Ryu Young-Joon is going to fight them.
“I don’t know yet.”
—Don’t mess with Lofair.
Park Joo-Hyuk gave Young-Joon a warning.
“Don’t mess with them?” Young-Joon asked.
“They’re too big of an enemy. They’re just a family, but they have too much influence in American politics and business.
“I’ve fought with the president of China, too.”
—That’s the problem, stupid! You’re the one who brought the president down.
Park Joo-Hyuk seemed worried.
—Now think of how tense and irritable other powerful figures will get when they get in a war of nerves with you. You’re the one who changed the Chinese regime, and you show your claws at me? Only ethics radicals like you would want to deal with punishment based on facts and fairness; most of them will just be thinking about killing you.
“...”
—I’ll tell you what I know about the Lofair family. They’re a family of financiers with roots in the Bank of Amsterdam.
Park Joo-Hyuk began explaining.
The descendants of Meyer Lofair, who ran the Bank of Amsterdam, the first bank established by the government, exported Dutch-style finance to England with King William III. This gave the British government so much credibility that it was able to borrow a lot of money at very low interest rates. That money provided the nation with the strength to build and maintain large warships. And this power was what helped Britain win the war against Napoleon.
“I can’t tell you myself, but at this rate, she’s going to die before we get any information out of her; she’s keeping her mouth shut. In my experience. harsh interrogation doesn’t yield information in cases like this.”
“I’m sure everyone else knows that too, so why are they choosing to do that?”
“That’s what I don’t understand either.”
“Is it that you don’t know? Or is it that you can’t tell me?”
“...”
Robert didn’t answer.
“You’re making all sorts of predictions, aren’t you? Like maybe there are people who would like Isaiah Franklin to die.”
“Nothing is certain.”
“... How can I help?”
“Give me the treatment. We need to buy some time first; if we can extend Isaiah Franklin’s life, it will give us another opportunity,” Robert said.
“Then, I’ll need at least a sample of her blood.”
“I knew you would say that, so I brought one.”
“Really?”
“Yes. And when I mentioned this to Isaiah Franklin while drawing her blood, she said that even a genius would find it easier to create a treatment if they had a sample of the medication she was taking. So, I also brought a small amount of the medication she was taking.”
Young-Joon flinched.
“Do you have an analysis of the ingredients in that medication?”
Young-Joon didn’t actually need that. But he also didn’t need the medication the patient was originally taking to create a treatment. And Doctor Ref knew this, meaning that this medication was some kind of signal she was sending him.
Even if Robert was going against orders to try to prolong Isaiah Franklin’s life, it was for the purpose of interrogation and information. Of course, he wouldn’t act as the carrier pigeon, delivering information secretly passed from Doctor Ref to Young-Joon without knowing the content. As such, this drug was a substance that the CIA had deemed safe for release.
“Of course, it was analyzed. Any drug that comes in or goes out of our headquarters is analyzed,” Robert said. “This drug was made by Isaiah Franklin herself, and it’s called Decitabine. This is the data sheet that our analytical team created.”
Robert handed Young-Joon a document. While reading it, Young-Joon realized something interesting.
“It’s not very pure, is it?”
“It’s a drug that she made by herself in a messy lab. Our team said that’s why it’s mixed with impurities, but they don’t know exactly what they are. There are so many different kinds of impurities in trace amounts that they can’t analyze them individually.”
“...”
Young-Joon laughed inside.
‘Isaiah Franklin... What an amazing woman.’
“Thank you.”
After Robert left, Young-Joon refrigerated the blood sample and began to look at Isaiah Franklin’s medication in Synchronization Mode. There was DNA in it—a tiny amount of DNA that was so diluted that it would not be observed experimentally if it was mixed in with other impurities.
It was such a small amount that the analysis team probably didn’t even know it was there, and there were probably so many other impurities that they didn’t care. And usually, it was normal for it not to matter, since it was hard to accurately analyze a DNA sequence that was less than ten bases long.
But Rosaline could do it. As the most stable molecular structure in the natural world, DNA not only contained the information of life, it could also contain the alphabet if made artificially.
DNA was composed of four molecules called adenine (A), guanine (G), cytosine (C), and thymine (T), strung together like a pearl necklace. They could be used to encrypt a sentence by putting them together in groups of three and assigning them an alphabet. For example, ACT represented the letter A, CAT represented the letter B, TCA represented the letter C, TAC represented the letter D, and so on.
There have been many attempts to use DNA as an information storage device since the mid-twentieth century.
Young-Joon read the first line of the enormous DNA molecule inside one of Doctor Ref’s medication capsules.
TACCTAACTCACAGCTACCACACGCACGACGAT
[DearDrRyu]
It was a message containing the life story of Isaiah Franklin, who was facing death, along with a significant accusation.
leonardwarren